Design and assembly
Design of the Autoculture Platform
Cell culture media were stored in Corning glass bottles with a multi-port solvent delivery cap. (4^{circ }hbox {C}) For the duration of the experiment. Each reservoir delivery cap contained a single 0.030″ ID × 0.090″ OD Tygon microbore tube (Masterflex), sealed by a two-piece PTFE nut and ferrule threaded adapter (Spex VapLock), extending from the bottom of the reservoir to an inlet port on the 6-port ceramic valve head of the syringe pump (Tecan Cavro Centris, 1.0-mL glass vial). The reservoir can be refilled with sterile air by using a 0.22-inch port.(upmu hbox {m}) To compensate for the draw of syringe pump chemicals, the cap has a filter (Millipore). The syringe pumps were connected using the same Tygon microbore tube, PTFE nut, and ferrule threaded adapters. Each 0.020″ ID × 0.060″ OD Tygon microbore tube (Masterflex) emanating from the distribution valve connects to a single well of the microfluidic chip. From this junction, fluidic isolation between wells can be maintained. Six wells are served by each 12-port distribution valve on the microfluidicchip. Two and four distribution valves were built. A collection of microbore tubes measuring 2m in length was wrapped into a braid to make it easy to handle. The tube was then guided through the rear entrance port of a Panasonic standard cell culture incubator (Fig. 2(4)). Incubation conditions(37^{circ }hbox {C}), 5% CO2, 95% rel. humidity), a single, custom-printed fluidic interface plat mated a set of microbore tube for reagent delivery into the inlets. A second, identical interface plates mated the set microbore tube for reagent aspiration towards the outlets.
The microbore tubes were used for aspiration and were redirected to an incubator. They were then transferred to a set single-use 15 mL conical tubes (Falcon), for conditioning media collection (Fig. 2(3)). Each collection reservoir was capped with a rubber stopper (McMaster) containing two 0.06” drilled holes. Each stopper was made up of a microbore tube to source microfluidic media and a dry micorbore tube for pneumatic operations back to the aspiration distributor valve head. To draw the conditioned media from microfluidic chips into the collection reservoir, the syringe pump was used in series to create negative pressure on each collection reservoir. The media influx was trapped in the collection reservoir by the separation of the conditioned media tube and the pneumatic tube. All microbore tube were hermetically sealed to distribution valve and syringe pumps with PTFEnut and ferrule threaded connectors.
The multi-pump wiring configuration was used to connect the syringe pump, distribution valves and the syringe pump. A Raspberry Pi 4 compute module relayed serial communications to Tecan OEM Communication Protocol via a GPIO RX/RX serial expansion board for Raspberry Pi (Ableconn). The Raspberry Pi compute module used a 7” touchscreen display to edit and launch protocols. To develop the software needed to automate protocols, an open-source Python program interface (API), was used.29.
Molding with PDMS
PDMS-based microfluidics are constructed with an interlocking 3D printing plastic mold (Fig. 4). These were printed using an SLA printer (Formlabs Form 3), with Model V2 resin. After printing, the molds were cured in N2 for 20 minutes with sonication in isopropanol. For 30 minutes, dry components were exposed to UV-light (405nm). (60,^{circ }hbox {C}). Fig. 3 The mold pieces were assembled and filled using PDMS (Sylgard 184 from Dow Corning). This was prepared by combining PDMS prepolymer with a curing agent (10 to 1 w/w). After filling the mold with PDMS, it was vacuumed for an hour in a chamber. The PDMS-filled mould is allowed to cure for 24 h (60,^{circ }hbox {C}) Before removing PDMS from mold.
Assembly of microfluidic chips
Borosilicate glass substrates ((101.6hbox {mm} times 127.0hbox {mm})McMaster-Carr) were washed in acetone (10 minutes), followed by isopropyl alcohol (10 minutes), and finally dried with N2. The glass substrate and molded PDMS surface were activated at 50 W for 45 s with oxygen plasma (Fig. 4C) were aligned manually, pressed together and baked at (100,^{circ }hbox {C}) Place on a hotplate for 30 minutes to form an irreversible seal
Parylene coating
A 10 (upmu hbox {m}) A layer of paryleneC (Specialty Coating Systems), which was deposited onto a microfluidic chip, was used to block PDMS absorption. Two drops silane A-174 from Sigma-Aldrich were placed in the deposition chamber to encourage adhesion.
3D-printed components
The fluidic interface plate (Fig. 4F) was 3D-printed to interface the 2.2 mm OD microbore (Cole-Palmer), and the PDMS inlet-outlet features. Each connector geometry had 24 cylindrical extrusions that had an OD of 2.5 mm and bore of 2.2mm. Three 0.2mm long barbs were located within each bore to hold the microbore tubing in place. The component was printed using a Formlabs SLA printer, Form 2, with Surgical Guide resin. After printing, the component was sonicated in isopropanol (IPA), for 20 minutes to remove excess resin. Finally, it was dried in N2. The components were dried and then exposed to UV light (405nm) for 30 minutes. (60,^{circ }hbox {C}). The part was coated in 5 (upmu hbox {m}) parylene C (Specialty Coating Systems). In the deposition chamber, two drops silane A-174 (Sigma-Aldrich), was also loaded to promote adhesion.
Organoid cell cultivation
Sterilization
According to Tecan’s supplier recommendations, sterilization of the syringe pumps, valve heads and tubing was performed. The platform was then pushed through to the collection reservoirs using the syringe pump for a 10-minute wash of 70% ethanol. After 70% ethanol was removed, a dry cycle using 0.22 air. (upmu hbox {m}) For 10 minutes, the filter (Millipore), was applied. The same parameters were used for ten subsequent cycles of deionized and nucleus-free water as well as drying. The microfluidic chip as well as media reservoirs were autoclaved. (121^{circ }hbox {C}) After 45 minutes, allow to dry for 15 minutes before using. All components were sealed in autoclavable bags and transferred to a biosafety cupboard in tissue culture for media loading and organoid. All components were pre-prepared and added media were transferred to the media reservoirs and sealed with a VapLock. They were then kept in refrigeration for the duration.
Maintenance of the hESC line
The H9 human embryonic stem cell strain (WiCell) was grown in StemFlex Medium (Gibco) on recombinant human virolin (Thermo). Subculturing was done by incubating plates in 0.5 mM EDTA over 5 minutes. The plates were then resuspended with culture medium and transferred to new coated plates.
Protocol and differentiation of the cerebral organoid.
For the production of cerebral organoids, adherent cells were separated using Accutase Cell Diffusion Reagent (Gibco). Then, they were aggregated in AggreWell 800 24-well plates by STEMCELL Technologies at a density 3,000,000 cells/well with 2mL AggreWell Medium supplemented with Rho Kinase inhibitor (Y-27632), 10 (upmu hbox {M}), Tocris, 1254) (day 0). Day 1, 1 mL AggreWell medium was replaced manually with supplemented medium containing WNT inhibitors (IWR1).(varepsilon), 3 (upmu hbox {M})Cayman Chemical 13659, days 1-10) and Nodal/Activin inhibitor (SB431542, Tocris (1614), 5 (upmu hbox {M})Day 1-10 Day 2: Aggregates were transferred onto a 37 (upmu hbox {m}) By carefully aspirating the AggreWell plate with a p1000 wide bore pipette, filter (STEMCELL technologies). By inverting the organoids and rinsing with AggreWell medium, they were transferred to ultra-low adhesion 6-well plates. The media were changed on the days 3, 4, 6, 8, 8 and 10. This was done by manually replacing 2mL of conditioned medium with fresh media. On day 11 and onward, the medium was changed to Neuronal Differentiation Medium containing Eagle Medium: Nutrient Mixture F-12 with GlutaMAX supplement (DMEM/F12, Thermo Fisher Scientific, 10565018), 1X N-2 Supplement (Thermo Fisher Scientific, 17502048), 1X Chemically Defined Lipid Concentrate (Thermo Fisher Scientific, 11905031) and 100 U/mL Penicillin/Streptomycin supplemented with 0.1% recombinant human Fibroblast Growth Factor b (Alamone F-170) and 0.1% recombinant human Epidermal Growth Factor (R &D systems 236-EG).
Control-group “Suspension” organoids remained suspended in 6-well plates and were maintained with 2 mL media changes every other day for the remainder of the culture. Experimental-group “Automated” organoids were loaded onto the microfluidic chip and experienced media changes of 70 (upmu hbox {L}) The rest of the culture is offered once per hour.
Microfluidic chip loading
The microfluidic chip for cerebral organoid differentiation was prepared on day 12 by pipetting 50 (upmu hbox {L}) Chilled (approximately (0,^{circ }hbox {C})) Matrigel hESC Qualif Matrix (BD 354277) into each well. After Matrigel, single cerebral organoids with 70 were transferred using a p1000 widebore pipette. (upmu hbox {L}) Apply native media to each well, and position the chip to the center-well to allow for imaging. Cover the chip with a 24-well plate cover and let it incubate for 24 hours. (37^{circ }hbox {C}) For 15 minutes, the Matrigel should be set. Each well was filled in with additional 70 (upmu hbox {L}) Connected to fluidic interface plate (Fig. 4F) were routed through the rear access port to the incubator. The microfluidic chips were pressure-fitted into the fluidic interface plates by hand. If applicable, the chip was then positioned on an imaging platform.
Analyse
Preparation for a sequencing library
Protocol Smart-seq236 It was used for generating full-length cDNA sequence libraries from whole organoid mRNA. Briefly, whole organoids were lysed using lysis buffer to render cell lysate containing polyadenylated mRNAs that were reverse transcribed with Superscript III (ThermoFisher Scientific) using an oligoDT primer (/5Me-isodC/AAGCAGTGGTATCAACGCAGA GTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN) and template switching was performed with a template switch oligo (AAGCAGTGGTATCAACGCAGAGTACATrGrGrG). The oligoDT primer and template switch oligo sequences served as primer sites for downstream cDNA amplification (AAGCAGTGGTATCAACGCAGAGT). Qubit 3.0 DNA high-sensitivity fluorometric assay was used to quantify cDNA. Quality was then assessed using an Agilent bioanalyzer DNA low sensitivity kit. Nextera HT transposase, Illumina, was used to convert 1ng of cDNA into barcoded sequence libraries.
Transcriptome analysis
Paired-end reads were sequenced at 75 × 75 bp on an Illumina NextSeq 550, and further depth was sequenced at 50×50 bp on an Illumina NovaSeq 6000 to an average read depth of 65 million paired reads per sample. Illumina i5 & i7 barcodes were used to demultiplex the samples. Higher depth samples were sub-sampled using SAMtools to 100M.37. The trimmed reads were combined with STAR alignment and aligned to human genome (hg38 UCSC assembly).38 (Gencode v37), using the toil–rnaseq pipeline39. STAR parameters came from ENCODE’s DCC pipeline40. The DESeq2 was used for differential gene expression.41 Package in RStudio Gene set enrichment analysis was done using g.Profiler42.
Immunostaining
The cerebral organoids were taken, then fixed in 4% paraffindehyde (ThermoFisher Scientific #28908), washed with 1X PBS, and then submerged into a 30% sucrose (Millipore® Sigma #S8501) in PBS solution. Samples were embedded in cryomolds (Sakura – Tissue-Tek Cryomold) containing tissue freezing medium (General Data, TFM-C), frozen and stored at − (80,^{circ }hbox {C}). At 18 (upmu hbox {M}) Put onto glass slides. The sections of organoids were washed three time in 1X PBS, followed by a 2-hour incubation with 10% BSA in PBS block solution (ThermoFisher Scientific#BP1605-100). The sections were then incubated overnight in primary antibodies in blocking solution. (4^{circ }hbox {C}). Next, three times were used to wash the sections with 1X PBS. This was done for 30 minutes. They were then incubated for 30 minutes in 1X PBS with secondary antibodies.
Primary antibodies were used: Rabbit anti SOX2 (1:50 dilution), Chicken anti Nestin (1:50 dilution) and DAPI (10mg) Secondary antibodies were used for goat anti-rabbit Alexa Fluor594 (ab150080), 1:250-dilution, and chicken anti Nestin (488) (ab150169), 1:250-dilution. The Zeiss AxioimagerZ2 Widefield Microscope was used at the UC Santa Cruz Institute for the Biology of Stem Cells (RRID :SCR_021135). Zen Pro software was also used. ImageJ was used to process the images.
Computational fluid dynamics
The fluid dynamics of filling and draining the wells were predicted using a commercial Computational Fluid Dynamics software COMSOL®Multiphysics 5.5 (Stockholm, Sweden). Figure 5B depicts the first 2 s in the filling cycle.(70, {upmu }hbox {L}) Media delivered at an average velocity (9.85 times 10^4,hbox {m/s})). The well is (5,hbox {mm}) The diameter is approximately 3.5 inches. (5.6,hbox {mm}). The media properties in this simulation were (997,hbox {kg/m}^3) The density (6.92 times 10^3,hbox {kg/ms}) viscosity. The simulation predicts that the phase boundary (between liquids and air) will be a free surface.43. The solution domain consists of a rigid wall (the well) with “non-slip” boundary conditions and the top surface (the air-media interface) open to the incubator with “slip” boundary conditions. The organoid was created as a phantom-sphere geometry using a (1.8,hbox {mm}) diameter. The atmospheric conditions were adjusted to a pressure of (1,hbox {atm})A temperature of (37,^{circ }hbox {C}), and a mixture of (5%) carbon dioxide, (17%) Oxygen, and (78%) nitrogen. We used stream arrow lines to visualize the velocity field at the center vertical cross-section. A total of 519 830 tetrahedral element were used in the simulation.